What is editing analysis?
When CRISPR plasmids is delivered to infected plants through agrobacterium tumefaciens to complete genetic transformation, we need to know whether the target gene in transgenic offspring is mutated and the type of mutation. There are generally two detection methods: 1) traditional Sanger sequencing, which is usually time-consuming and laborious. 2) Illumina high throughput sequencing. More ....
How to do?
- Primrt and Barcode design;
- PCR amplification and product mixing;
- Illumina sequence;
- Analysis and plot;
1. Barcode Primers Design
The primer is all 5'-3' and have format: Barcode + primer;
According to the location of sgRNA, DNA sequence was used as template to design forward and reverse primers with amplification length less than 250bp;
Use Barcode Primers Design to design barcode and add it to the 5' of the above primers;
All transgenic plants were amplified by PCR with the primers added with barcode sequence.
2. Illumina Sequence
The library was constructed using mixed PCR products, which have purified, and high-throughput sequencing was performed on the Illumina platform.
3. Prepare Files
All files are tab (\t) delimited and all the sequence is 5'-3'.
3.1 Primers File
Note: Lower case letters represent barcode sequence, and upper case letters represent primers of target interval amplification sequence.
Note: F: Forward primer. R: Reverse primer.
| sample1-F | cgagacaTTAAGAGAAGTACCAGTGTAAGTGC |
|---|---|
| sample1-R | tgtctcgAATTTTTTCCATCTGCAGTTACT |
3.2 Editing Information
Note: The first column represents the name of the sample and must exactly same as the name in the primer file.
Note: The second column represents the amplification sequence of target gene.
Note: The third column represents sgRNA and no PAM.
| sample1 | TTAAGAGAAGTACCAGTGTAAGTGCCCTTGGGTGTAGTTCACCCATTTTTAAATAACAAGTTTTTCCTTGTCTCATGTACTAAACGTGTCCCTAAGTTGATGCTAGA | TGTCTCATGTACTAAACGTG |
|---|
4. Editing Analysis
Clone the software of CRISPR_Barcode_HiTom_Analysis and modify the config.yaml file for editing analysis.
Then run it with command as follows:
snakemake -j 100 -s workflow/Snakefile --use-conda --cluster-config config/cluster.json --cluster "bsub -q normal -o {cluster.output} -e {cluster.error} -n {threads}"